Review




Structured Review

Premier Biosoft primer 3 plus
Primer 3 Plus, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/5+premier+primer/10__3390_slash_fishes10050205-108-5-8
Average 86 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

other:

Article Title: Nitrite induces hepatic glucose and lipid metabolism disorders in zebrafish through mitochondrial dysfunction and ERs response.
Article Snippet: Nitrite, a highly toxic environmental contaminant, induces various physiological toxicities in aquatic animals.. Herein, we investigate the in vivo effects of nitrite exposure at concentrations of 0, 0.2, 2, and 20 mg/L on glucose and lipid metabolism in zebrafish.. Our results showed that exposure to nitrite induced mitochondrial oxidative stress in zebrafish liver and ZFL cells, which were evidenced by increased levels of malondialdehyde (MDA) and reactive oxygen species (ROS) as well as decreased mitochondrial membrane potential (MMP) and adenosine triphosphate (ATP).

Article Title: Increased CO2 Concentration Mitigates the Impact of Nitrite on Zebrafish (Danio rerio) Liver and Gills
Article Snippet: The primers were designed by Primer 3 Plus (Premier Biosoft International, Andreas, Helen, GA, USA) and are listed in Table A1.

Article Title: Increased CO2 Concentration Mitigates the Impact of Nitrite on Zebrafish (Danio rerio) Liver and Gills
Article Snippet: The primers were designed by Primer 3 Plus (Premier Biosoft International, Andreas, Helen, GA, USA).



Similar Products

86
Sangon Biotech primer 3 plus
Primer 3 Plus, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/0+5+primer+software/pm42301356-71-9-16
Average 86 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

98
TaKaRa 3 smart seq cds primer iia
3 Smart Seq Cds Primer Iia, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/SMART-Seq+v4+PLUS+Kit/us12629681-230-13-22
Average 98 stars, based on 1 article reviews
3 smart seq cds primer iia - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

86
Kuraray Noritake Dental solvent acetone ceramic primer clearfil ceramic primer plus kuraray noritake 3 methacryloxypropyl trimethoxysilane
Solvent Acetone Ceramic Primer Clearfil Ceramic Primer Plus Kuraray Noritake 3 Methacryloxypropyl Trimethoxysilane, supplied by Kuraray Noritake Dental, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/ceramic+primer/pm41277379-66-49-57
Average 86 stars, based on 1 article reviews
solvent acetone ceramic primer clearfil ceramic primer plus kuraray noritake 3 methacryloxypropyl trimethoxysilane - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Premier Biosoft primer 3 plus
Primer 3 Plus, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/5+premier+primer/10__3390_slash_fishes10050205-108-5-8
Average 86 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
PrimerDesign Inc primer 3 plus
Primer 3 Plus, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/primer3/pmc11769096-107-14-0
Average 90 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

98
Toyobo mena seq4 5 3 150 taccgtgattatttgtccgc primers
Mena Seq4 5 3 150 Taccgtgattatttgtccgc Primers, supplied by Toyobo, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/KOD+-Plus-+Neo/pm39544141-63-15-24
Average 98 stars, based on 1 article reviews
mena seq4 5 3 150 taccgtgattatttgtccgc primers - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

90
Biotechnology Information primer-blast software version primer 3 plus
Primer Blast Software Version Primer 3 Plus, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/primer+blast+software+version+primer+3+plus/pmc11591826-111-4-13
Average 90 stars, based on 1 article reviews
primer-blast software version primer 3 plus - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results